ID: 1102454352_1102454365

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1102454352 1102454365
Species Human (GRCh38) Human (GRCh38)
Location 12:113062729-113062751 12:113062762-113062784
Sequence CCCGTGCAGTGCAGCCAGCGGAA GTGTCAGGCTGGGGCCACAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 336} {0: 1, 1: 0, 2: 3, 3: 40, 4: 349}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!