ID: 1102457930_1102457941

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1102457930 1102457941
Species Human (GRCh38) Human (GRCh38)
Location 12:113082337-113082359 12:113082364-113082386
Sequence CCTCTGGCTCTCAAGACCCGTGG TGTTGCTGGGGAAGGGGAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120} {0: 1, 1: 1, 2: 9, 3: 82, 4: 887}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!