ID: 1102459073_1102459084

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1102459073 1102459084
Species Human (GRCh38) Human (GRCh38)
Location 12:113089155-113089177 12:113089203-113089225
Sequence CCCTGGGGTGGGAGTGTGCCTGG CAGGGTGGCTGGAGTGGAGTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 30, 3: 159, 4: 641} {0: 2, 1: 2, 2: 25, 3: 139, 4: 821}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!