ID: 1102464271_1102464280

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1102464271 1102464280
Species Human (GRCh38) Human (GRCh38)
Location 12:113119384-113119406 12:113119425-113119447
Sequence CCCCAAAACACACGTGCAAATGG GTCTCTGGGAGCCAGGTCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 171} {0: 1, 1: 0, 2: 5, 3: 24, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!