ID: 1102474655_1102474662

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1102474655 1102474662
Species Human (GRCh38) Human (GRCh38)
Location 12:113180821-113180843 12:113180849-113180871
Sequence CCCAACCACAGTGCTGGGCCCAG ACATCAGTGATGGAGTGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 32, 4: 317} {0: 1, 1: 0, 2: 1, 3: 55, 4: 936}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!