ID: 1102488738_1102488745

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1102488738 1102488745
Species Human (GRCh38) Human (GRCh38)
Location 12:113276196-113276218 12:113276214-113276236
Sequence CCTTTGATCCACAGGGAAAAAAT AAAATGGGGGACCAGTTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 298} {0: 1, 1: 0, 2: 1, 3: 13, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!