ID: 1102489315_1102489321

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1102489315 1102489321
Species Human (GRCh38) Human (GRCh38)
Location 12:113279697-113279719 12:113279716-113279738
Sequence CCCGACCCCGATAATATATTTTT TTTTGCCCTCCTCTTATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 699} {0: 1, 1: 0, 2: 0, 3: 8, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!