ID: 1102498828_1102498833

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1102498828 1102498833
Species Human (GRCh38) Human (GRCh38)
Location 12:113337393-113337415 12:113337429-113337451
Sequence CCTTCTATAAACACTTAGAGCCT AGTTTCCCCCTTGGTGAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 130} {0: 1, 1: 3, 2: 36, 3: 231, 4: 1432}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!