ID: 1102511749_1102511755

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1102511749 1102511755
Species Human (GRCh38) Human (GRCh38)
Location 12:113420788-113420810 12:113420815-113420837
Sequence CCAGGACAAGGCACCCAACAAGG ATGTGTGTCTAAAGCGAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 117} {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!