ID: 1102513825_1102513827

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1102513825 1102513827
Species Human (GRCh38) Human (GRCh38)
Location 12:113433674-113433696 12:113433693-113433715
Sequence CCTATGTGCCATCTCTCTGGCTG GCTGCTTGAACTCAACTAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 220} {0: 1, 1: 0, 2: 1, 3: 6, 4: 71}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!