ID: 1102514143_1102514149

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1102514143 1102514149
Species Human (GRCh38) Human (GRCh38)
Location 12:113435288-113435310 12:113435312-113435334
Sequence CCTCCCTCACTCTGCTTCTCCCT TCACCCCCCCTCCCCAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 23, 3: 276, 4: 2328} {0: 1, 1: 0, 2: 2, 3: 39, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!