ID: 1102534809_1102534816

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1102534809 1102534816
Species Human (GRCh38) Human (GRCh38)
Location 12:113573531-113573553 12:113573567-113573589
Sequence CCCTAGAGCCAATGTTGTGACAG TGGATGGTGAATCAGCCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 3, 4: 101} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!