ID: 1102542278_1102542284

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1102542278 1102542284
Species Human (GRCh38) Human (GRCh38)
Location 12:113630067-113630089 12:113630096-113630118
Sequence CCAGAATCAAGGTATCATCAGTG TCCTTCCTGGAGGCTCTAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 412} {0: 1, 1: 4, 2: 21, 3: 72, 4: 323}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!