ID: 1102542278_1102542286

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1102542278 1102542286
Species Human (GRCh38) Human (GRCh38)
Location 12:113630067-113630089 12:113630097-113630119
Sequence CCAGAATCAAGGTATCATCAGTG CCTTCCTGGAGGCTCTAGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 51, 4: 412} {0: 3, 1: 3, 2: 6, 3: 64, 4: 343}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!