|
Left Crispr |
Right Crispr |
| Crispr ID |
1102569765 |
1102569778 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:113820398-113820420
|
12:113820434-113820456
|
| Sequence |
CCAGGCAGAGGGAAGAGGCAGCT |
GTGGGAGCCTGCAGGGAGGAAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 0, 2: 14, 3: 115, 4: 685} |
{0: 1, 1: 0, 2: 10, 3: 88, 4: 796} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|