ID: 1102572737_1102572740

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1102572737 1102572740
Species Human (GRCh38) Human (GRCh38)
Location 12:113837150-113837172 12:113837203-113837225
Sequence CCATCCTCCTACTTAATATACAC ACTCTCACGTGCTACTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 177} {0: 1, 1: 0, 2: 0, 3: 5, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!