ID: 1102574577_1102574581

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1102574577 1102574581
Species Human (GRCh38) Human (GRCh38)
Location 12:113848216-113848238 12:113848230-113848252
Sequence CCACTTTTCATTATCAGGCTAAA CAGGCTAAAGAGTGGGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 225} {0: 1, 1: 0, 2: 0, 3: 32, 4: 398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!