ID: 1102583875_1102583884

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1102583875 1102583884
Species Human (GRCh38) Human (GRCh38)
Location 12:113909735-113909757 12:113909779-113909801
Sequence CCTTCTCACCTCCAGACCCACTT CCCAAACAGTGTTCCTGACGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 50, 4: 477} {0: 1, 1: 0, 2: 0, 3: 7, 4: 84}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!