ID: 1102585592_1102585598

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1102585592 1102585598
Species Human (GRCh38) Human (GRCh38)
Location 12:113920565-113920587 12:113920592-113920614
Sequence CCTGCCAAGTGCCTCCGTGGCCC CTGAGAATCTTCACTTTACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191} {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!