ID: 1102589820_1102589827

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1102589820 1102589827
Species Human (GRCh38) Human (GRCh38)
Location 12:113948814-113948836 12:113948846-113948868
Sequence CCGGAGGCCACACCCCTACCATA GAGCTTCTCCAGATCCTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183} {0: 1, 1: 0, 2: 8, 3: 24, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!