ID: 1102589822_1102589828

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1102589822 1102589828
Species Human (GRCh38) Human (GRCh38)
Location 12:113948821-113948843 12:113948852-113948874
Sequence CCACACCCCTACCATATTTGGAG CTCCAGATCCTCCTCGGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152} {0: 1, 1: 0, 2: 1, 3: 18, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!