ID: 1102589826_1102589835

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1102589826 1102589835
Species Human (GRCh38) Human (GRCh38)
Location 12:113948832-113948854 12:113948885-113948907
Sequence CCATATTTGGAGAAGAGCTTCTC GTTCCGTACAAAGAGCCTTCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 16, 4: 166} {0: 1, 1: 0, 2: 0, 3: 0, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!