ID: 1102602468_1102602473

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1102602468 1102602473
Species Human (GRCh38) Human (GRCh38)
Location 12:114042402-114042424 12:114042426-114042448
Sequence CCTTGTTCATTCTGGGAGCCCTA ATTGATTTGATTCAGGGTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 10, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!