ID: 1102616063_1102616071

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1102616063 1102616071
Species Human (GRCh38) Human (GRCh38)
Location 12:114155331-114155353 12:114155376-114155398
Sequence CCTAACTCAGGCAACCTATTCCT ATCAGTTACAACTTCAGGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!