ID: 1102622096_1102622104

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1102622096 1102622104
Species Human (GRCh38) Human (GRCh38)
Location 12:114204240-114204262 12:114204277-114204299
Sequence CCAATCCCAGTCAGGTTGGCCCT CAGATCCCGAATTTTTTGTAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!