ID: 1102622096_1102622111

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1102622096 1102622111
Species Human (GRCh38) Human (GRCh38)
Location 12:114204240-114204262 12:114204289-114204311
Sequence CCAATCCCAGTCAGGTTGGCCCT TTTTTGTAGGGTGTTGCGGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 0, 3: 18, 4: 273}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!