ID: 1102639309_1102639315

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1102639309 1102639315
Species Human (GRCh38) Human (GRCh38)
Location 12:114352508-114352530 12:114352558-114352580
Sequence CCATTGGGCACTCTGTCTTTGTA GGATGCACATAATTTCCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 266} {0: 1, 1: 0, 2: 0, 3: 12, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!