ID: 1102644185_1102644191

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1102644185 1102644191
Species Human (GRCh38) Human (GRCh38)
Location 12:114393243-114393265 12:114393283-114393305
Sequence CCTTGCTGGTGGGGACTGTAGCT CACCATCTCCACATCCATCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 166} {0: 1, 1: 0, 2: 2, 3: 21, 4: 206}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!