ID: 1102646164_1102646173

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1102646164 1102646173
Species Human (GRCh38) Human (GRCh38)
Location 12:114405350-114405372 12:114405366-114405388
Sequence CCCTCGCCAGGGTCCCGGGGAGC GGGGAGCTCTGGGCTGGCGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 173} {0: 1, 1: 0, 2: 4, 3: 63, 4: 641}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!