ID: 1102646280_1102646288

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1102646280 1102646288
Species Human (GRCh38) Human (GRCh38)
Location 12:114405932-114405954 12:114405947-114405969
Sequence CCCGCTCCTCCTTTACACCCCCA CACCCCCAGGGAGGGAAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 483} {0: 1, 1: 0, 2: 1, 3: 27, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!