ID: 1102646416_1102646426

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1102646416 1102646426
Species Human (GRCh38) Human (GRCh38)
Location 12:114406698-114406720 12:114406725-114406747
Sequence CCCCACCCAGTGGGGCCACCAGA CCCTGCTCCAGGTGTACACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 47, 4: 197} {0: 1, 1: 0, 2: 1, 3: 21, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!