ID: 1102678063_1102678082

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1102678063 1102678082
Species Human (GRCh38) Human (GRCh38)
Location 12:114672023-114672045 12:114672075-114672097
Sequence CCGAGGCCGGGCTGGCGGCCAGG GGCCGCCGCCATGGAGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 42, 4: 391} {0: 1, 1: 0, 2: 2, 3: 20, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!