ID: 1102679816_1102679822

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1102679816 1102679822
Species Human (GRCh38) Human (GRCh38)
Location 12:114683867-114683889 12:114683881-114683903
Sequence CCGCCCTCCTCCTCCTTCCTCTG CTTCCTCTGCTCCGAGCCTCCGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 66, 3: 683, 4: 3728} {0: 1, 1: 0, 2: 2, 3: 25, 4: 328}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!