ID: 1102679816_1102679824

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1102679816 1102679824
Species Human (GRCh38) Human (GRCh38)
Location 12:114683867-114683889 12:114683884-114683906
Sequence CCGCCCTCCTCCTCCTTCCTCTG CCTCTGCTCCGAGCCTCCGGAGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 66, 3: 683, 4: 3728} {0: 1, 1: 0, 2: 5, 3: 15, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!