ID: 1102680654_1102680657

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1102680654 1102680657
Species Human (GRCh38) Human (GRCh38)
Location 12:114688253-114688275 12:114688270-114688292
Sequence CCTCGTTTCTGCCCAGTGCCCCA GCCCCAGCCCATTTGATCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 232} {0: 1, 1: 0, 2: 1, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!