ID: 1102738476_1102738479

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1102738476 1102738479
Species Human (GRCh38) Human (GRCh38)
Location 12:115184733-115184755 12:115184761-115184783
Sequence CCAACATGCAGACATATTGCATG GAAAATGTTTGTTGAATGAGCGG
Strand - +
Off-target summary No data {0: 2, 1: 2, 2: 25, 3: 153, 4: 775}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!