ID: 1102739821_1102739830

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1102739821 1102739830
Species Human (GRCh38) Human (GRCh38)
Location 12:115197202-115197224 12:115197247-115197269
Sequence CCTGATGCTTCCTTGCAACCCTG GCTGTCTCTTTCGGCTCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!