ID: 1102784448_1102784453

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1102784448 1102784453
Species Human (GRCh38) Human (GRCh38)
Location 12:115592826-115592848 12:115592845-115592867
Sequence CCATCCTCCAGCTGTTTGCCCAC CCACAAATATCAGACACTGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 1, 3: 22, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!