ID: 1102818574_1102818587

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1102818574 1102818587
Species Human (GRCh38) Human (GRCh38)
Location 12:115888564-115888586 12:115888612-115888634
Sequence CCCCCTGTATGTCCTTGGGTAAC CTCCTCAGCTGTCTACCTGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!