ID: 1102823561_1102823569

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1102823561 1102823569
Species Human (GRCh38) Human (GRCh38)
Location 12:115927597-115927619 12:115927630-115927652
Sequence CCCCAGGGCCAGCATGGAAGACT GGTGATGTCTGAGCAGAGACTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 12, 3: 40, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!