ID: 1102836902_1102836908

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1102836902 1102836908
Species Human (GRCh38) Human (GRCh38)
Location 12:116072274-116072296 12:116072300-116072322
Sequence CCTTTAAAATGATCTGGTCCAAA CTGGTTTTCTTGATGAACAATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 30, 4: 279} {0: 1, 1: 0, 2: 2, 3: 19, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!