ID: 1102854893_1102854897

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1102854893 1102854897
Species Human (GRCh38) Human (GRCh38)
Location 12:116285228-116285250 12:116285279-116285301
Sequence CCAAAAAAGGGGTGAACTATATT CTAAGTTTCTTACACATTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 12, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!