ID: 1102908888_1102908894

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1102908888 1102908894
Species Human (GRCh38) Human (GRCh38)
Location 12:116697511-116697533 12:116697533-116697555
Sequence CCCAGAGGACACTGGAGACTAGG GCCATGTCTGGAGACATTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 264} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!