ID: 1102910368_1102910375

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1102910368 1102910375
Species Human (GRCh38) Human (GRCh38)
Location 12:116708971-116708993 12:116709021-116709043
Sequence CCCACCAGATGGTTCTCATCTAT GAGAGCTCCACGCAGGCACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 133} {0: 1, 1: 0, 2: 0, 3: 7, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!