ID: 1102911763_1102911769

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1102911763 1102911769
Species Human (GRCh38) Human (GRCh38)
Location 12:116720494-116720516 12:116720534-116720556
Sequence CCTCCCTACCAGGGATGACCATG CACAGACAGAAGCTGGAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 148} {0: 1, 1: 0, 2: 2, 3: 31, 4: 332}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!