ID: 1102913751_1102913764 |
View in Genome Browser |
Spacer: 2 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1102913751 | 1102913764 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 12:116737885-116737907 | 12:116737910-116737932 |
| Sequence | CCGCCAGGTTCACCATCCCGGCG | GACGTGGGGCGCGGCGGCCGGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 7, 4: 83} | {0: 1, 1: 0, 2: 7, 3: 39, 4: 390} |
| Status | Complete | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| 2 | 12:116737885-116737907 | CCGCCAGGTTCACCATCCCGGCG | - | 12:116737910-116737932 | GACGTGGGGCGCGGCGGCCGGGG | + | ||
| 164 | 19:35717919-35717941 | CCGCGGCCGCCCCGCCCCGCCCC | - | 19:35718106-35718128 | GGCGGGGGCCGCGGCGGACGGGG | + | ||