|
Left Crispr |
Right Crispr |
| Crispr ID |
1102914357 |
1102914364 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:116741899-116741921
|
12:116741932-116741954
|
| Sequence |
CCTTGATCTCTCAAAGCCCTGGG |
TGAACCACTGCACCTGGCATGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 3, 2: 52, 3: 1123, 4: 15338} |
{0: 1, 1: 11, 2: 264, 3: 1085, 4: 3099} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|