ID: 1102915717_1102915730

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1102915717 1102915730
Species Human (GRCh38) Human (GRCh38)
Location 12:116750331-116750353 12:116750378-116750400
Sequence CCTAGCCATGGGCTTCACAGGCA GGGCTCCTCCTCTGAAGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 208} {0: 1, 1: 0, 2: 2, 3: 42, 4: 490}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!