ID: 1102932555_1102932561

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1102932555 1102932561
Species Human (GRCh38) Human (GRCh38)
Location 12:116873903-116873925 12:116873917-116873939
Sequence CCCCCACCCAACAGCAGGGGCAC CAGGGGCACCAGTTTAGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 295} {0: 1, 1: 0, 2: 0, 3: 6, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!