ID: 1102941708_1102941713

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1102941708 1102941713
Species Human (GRCh38) Human (GRCh38)
Location 12:116948156-116948178 12:116948205-116948227
Sequence CCTGGAAATGATTTGCTAAACTA CCTAGTGTTTGCATAAATGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 188} {0: 1, 1: 0, 2: 3, 3: 10, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!